There are 3 posibilities to enter your sequence. 1. Just write or cut/paste your sequence into the field. In this case all numbers and spaces are removed, and all characters except c,g,u,a and t are automatically converted to n. You may name your sequence in the field above (optionally). 2. You can write or cut/paste your sequence in the FASTA-Format. The name of your sequence will then be extracted out of your entry. 3. You can write or cut/paste a whole series of sequences in the FASTA-Format into the field. Just write the sequences one after another. You MUST check the appropriate box in this case. FASTA-Format: >Your sequence id ccgcgcggcguauaucgcgcgcguagcgagcgagcucgagc ccguuagcggagcggaucgcgcggcgagaaauaauagcgcg