There are 3 posibilities to enter your sequence.
1.  Just write or cut/paste your sequence into the field. 
    In this case all numbers and spaces are removed, and all
    characters except c,g,u,a and t are automatically converted
    to n. You may name your sequence in the field above (optionally).

2.  You can write or cut/paste your sequence in the FASTA-Format. 
    The name of your sequence will then be extracted out of your entry.

3.  You can write or cut/paste a whole series of sequences in the
    FASTA-Format into the field. Just write the sequences one after another.
    You MUST check the appropriate box in this case.

FASTA-Format:
    
>Your sequence id
ccgcgcggcguauaucgcgcgcguagcgagcgagcucgagc
ccguuagcggagcggaucgcgcggcgagaaauaauagcgcg